Clinicopathological and pedigree investigation of a novel spinocerebellar neurological disease in juvenile Quarter Horses in North America.

BACKGROUND: In 2020, a novel neurologic disease was observed in juvenile Quarter Horses (QHs) in North America. It was unknown if this was an aberrant manifestation of another previously described neurological disorder in foals, such as equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM). HYPOTHESIS/OBJECTIVES: To describe the clinical findings, outcomes, and postmortem changes with Equine Juvenile Spinocerebellar Ataxia (EJSCA), differentiate the disease from other similar neurological disorders, and determine a mode of inheritance. ANIMALS: Twelve neurologically affected QH foals and the dams. METHODS: Genomic DNA was isolated and pedigrees were manually constructed. RESULTS: All foals (n = 12/12) had a history of acute onset of neurological deficits with no history of trauma. Neurological deficits were characterized by asymmetrical spinal ataxia, with pelvic limbs more severely affected than thoracic limbs. Clinicopathological abnormalities included high serum activity of gamma-glutamyl transferase and hyperglycemia. All foals became recumbent (median, 3 days: [0-18 days]), which necessitated humane euthanasia (n = 11/12, 92%; the remaining case was found dead). Histological evaluation at postmortem revealed dilated myelin sheaths and digestion chambers within the spinal cord, most prominently in the dorsal spinocerebellar tracts. Pedigree analysis revealed a likely autosomal recessive mode of inheritance. CONCLUSIONS AND CLINICAL IMPORTANCE: EJSCA is a uniformly fatal, rapidly progressive, likely autosomal recessive neurological disease of QHs <1 month of age in North America that is etiologically distinct from other clinically similar neurological disorders. Once the causative variant for EJSCA is validated, carriers can be identified through genetic testing to inform breeding decisions.

Composition of thrombi in zebrafish: similarities and distinctions with mammals.

BACKGROUND: Blood clots are primarily composed of red blood cells (RBCs), platelets/thrombocytes, and fibrin. Despite the similarities observed between mammals and zebrafish, the composition of fish thrombi is not as well known. OBJECTIVES: To analyze the formation of zebrafish blood clots ex vivo and arterial and venous thrombi in vivo. METHODS: Transgenic zebrafish lines and laser-mediated endothelial injury were used to determine the relative ratio of RBCs and thrombocytes in clots. Scanning electron and confocal microscopy provided high-resolution images of the structure of adult and larval clots. Adult and larval thrombocyte spreading on fibrinogen was evaluated ex vivo. RESULTS: RBCs were present in arterial and venous thrombi, making up the majority of cells in both circulations. However, bloodless mutant fish demonstrated that fibrin clots can form in vivo in the absence of blood cells. Scanning electron and confocal microscopy showed that larval and adult zebrafish thrombi and mammalian thrombi look surprisingly similar externally and internally, even though the former have nucleated RBCs and thrombocytes. Although adult thrombocytes spread on fibrinogen, we found that larval cells do not fully activate without the addition of plasma from adult fish, suggesting a developmental deficiency of a plasma activating factor. Finally, mutants lacking αIIbß3 demonstrated that this integrin mediates thrombocyte spreading on fibrinogen. CONCLUSION: Our data showed strong conservation of arterial and venous and clot/thrombus formation across species, including developmental regulation of thrombocyte function. This correlation supports the possibility that mammals also do not absolutely require circulating cells to form fibrin clots in vivo.

Functional annotation of the animal genomes: An integrated annotation resource for the horse.

The genomic sequence of the horse has been available since 2009, providing critical resources for discovering important genomic variants regarding both animal health and population structures. However, to fully understand the functional implications of these variants, detailed annotation of the horse genome is required. Due to the limited availability of functional data for the equine genome, as well as the technical limitations of short-read RNA-seq, existing annotation of the equine genome contains limited information about important aspects of gene regulation, such as alternate isoforms and regulatory elements, which are either not transcribed or transcribed at a very low level. To solve above problems, the Functional Annotation of the Animal Genomes (FAANG) project proposed a systemic approach to tissue collection, phenotyping, and data generation, adopting the blueprint laid out by the Encyclopedia of DNA Elements (ENCODE) project. Here we detail the first comprehensive overview of gene expression and regulation in the horse, presenting 39,625 novel transcripts, 84,613 candidate cis-regulatory elements (CRE) and their target genes, 332,115 open chromatin regions genome wide across a diverse set of tissues. We showed substantial concordance between chromatin accessibility, chromatin states in different genic features and gene expression. This comprehensive and expanded set of genomics resources will provide the equine research community ample opportunities for studies of complex traits in the horse.

Transcriptomic Markers of Recombinant Human Erythropoietin Micro-Dosing in Thoroughbred Horses.

Recombinant human erythropoietin (rHuEPO) is a well-known performance enhancing drug in human athletes, and there is anecdotal evidence of it being used in horse racing for the same purpose. rHuEPO, like endogenous EPO, increases arterial oxygen content and thus aerobic power. Micro-doping, or injecting smaller doses over a longer period of time, has become an important concern in both human and equine athletics since it is more difficult to detect. Horses offer an additional challenge of a contractile spleen, thus large changes in the red blood cell mass occur naturally. To address the challenge of detecting rHuEPO doping in horse racing, we determined the transcriptomic effects of rHuEPO micro-dosing over seven weeks in exercised Thoroughbreds. RNA-sequencing of peripheral blood mononuclear cells isolated at several time points throughout the study identified three transcripts (C13H16orf54, PUM2 and CHTOP) that were significantly (PFDR < 0.05) different between the treatment groups across two or three time point comparisons. PUM2 and CHTOP play a role in erythropoiesis while not much is known about C13H16orf54, but it is primarily expressed in whole blood. However, gene expression differences were not large enough to detect via RT-qPCR, thereby precluding their utility as biomarkers of micro-doping.

Increased α-tocopherol metabolism in horses with equine neuroaxonal dystrophy.

BACKGROUND: Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin E consists of 8 isoforms metabolized by the CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM. HYPOTHESIS/OBJECTIVES: Based on the association of α-tocopherol deficiency with the development of eNAD/EDM, we hypothesized that the rate of α-tocopherol, but not γ-tocopherol or tocotrienol metabolism, would be increased in eNAD/EDM-affected horses. ANIMALS: Vitamin E metabolism: Proof of concept (POC) study; eNAD/EDM-affected (n = 5) and control (n = 6) horses. Validation study: eNAD/EDM-affected Quarter Horses (QHs; n = 6), cervical vertebral compressive myelopathy affected (n = 6) horses and control (n = 29) horses. CYP4F2 expression and copy number: eNAD/EDM-affected (n = 12) and age- and sex-matched control (n = 11-12) horses. METHODS: The rates of α-tocopherol/tocotrienol and γ-tocopherol/tocotrienol metabolism were assessed in equine serum (POC and validation) and urine (POC only) using liquid chromatography tandem mass spectrometry (LC-MS/MS). Quantitative reverse-transcriptase PCR (qRT-PCR) and droplet digital (dd)-PCR were used to assay expression and genomic copy number of a CYP4F2 equine ortholog. RESULTS: Metabolic rate of α-tocopherol was increased in eNAD/EDM horses (POC,P < .0001; validation, P = .03), with no difference in the metabolic rate of γ-tocopherol. Horses with eNAD/EDM had increased expression of the CYP4F2 equine orthologue (P = .02) but no differences in copy number. CONCLUSIONS AND CLINICAL IMPORTANCE: Increased α-tocopherol metabolism in eNAD/EDM-affected QHs provides novel insight into alterations in vitamin E processing in eNAD/EDM and highlights the need for high-dose supplementation to prevent the clinical phenotype in genetically susceptible horses.

Genetics of equine bleeding disorders.

Genetic bleeding disorders can have a profound impact on a horse's health and athletic career. As such, it is important to understand the mechanisms of these diseases and how they are diagnosed. These diseases include haemophilia A, von Willebrand disease, prekallikrein deficiency, Glanzmann's Thrombasthenia and Atypical Equine Thrombasthenia. Exercise-induced pulmonary haemorrhage also has a proposed genetic component. Genetic mutations have been identified for haemophilia A and Glanzmann's Thrombasthenia in the horse. Mutations are known for von Willebrand disease and prekallikrein deficiency in other species. In the absence of genetic tests, bleeding disorders are typically diagnosed by measuring platelet function, von Willebrand factor, and other coagulation protein levels and activities. For autosomal recessive diseases, genetic testing can prevent the breeding of two carriers.

A nonsense variant in Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) is associated with equine familial isolated hypoparathyroidism in Thoroughbred foals.

Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9-54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.

Comparison of Poly-A+ Selection and rRNA Depletion in Detection of lncRNA in Two Equine Tissues Using RNA-seq.

Long non-coding RNAs (lncRNAs) are untranslated regulatory transcripts longer than 200 nucleotides that can play a role in transcriptional, post-translational, and epigenetic regulation. Traditionally, RNA-sequencing (RNA-seq) libraries have been created by isolating transcriptomic RNA via poly-A+ selection. In the past 10 years, methods to perform ribosomal RNA (rRNA) depletion of total RNA have been developed as an alternative, aiming for better coverage of whole transcriptomic RNA, both polyadenylated and non-polyadenylated transcripts. The purpose of this study was to determine which library preparation method is optimal for lncRNA investigations in the horse. Using liver and cerebral parietal lobe tissues from two healthy Thoroughbred mares, RNA-seq libraries were prepared using standard poly-A+ selection and rRNA-depletion methods. Averaging the two biologic replicates, poly-A+ selection yielded 327 and 773 more unique lncRNA transcripts for liver and parietal lobe, respectively. More lncRNA were found to be unique to poly-A+ selected libraries, and rRNA-depletion identified small nucleolar RNA (snoRNA) to have a higher relative expression than in the poly-A+ selected libraries. Overall, poly-A+ selection provides a more thorough identification of total lncRNA in equine tissues while rRNA-depletion may allow for easier detection of snoRNAs.

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.